Ir a contenido


Foto

Problemas de Genética


  • Inicia sesión para responder
225 Respuesta(s) a este Tema

#21 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 20 abril 2008 - 11:48



smile_031.gif


Más material de apoyo....

_____________________________________________




Preguntas




Respuestas




_______________________________________________




#22 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 23 abril 2008 - 07:59





smile_031.gif


Subimos otro...

__________________________





________________________________________________





#23 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 25 abril 2008 - 01:47




smile_031.gif


Subimos dos imágenes más del Depto. de Biología del Colegio San Cayetano, el autor no pone su nombre, por eso no aparece acá. Como pueden ver, son muy didácticos...

_____________________________________________










__________________________________________________



#24 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 16 mayo 2008 - 10:41



smile_031.gif

Un aporte del San Cayetano

_________________________________







___________________________________





#25 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 06 junio 2008 - 06:40




smile_031.gif


_______________________________________________
























___________________________________________________





#26 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 10 junio 2008 - 11:18






smile_031.gif



Una anotación que ya hice en otro tema, cada "Solución" es un apunte...


_____________________________________





























_________________________________________________








#27 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 11 junio 2008 - 06:47



smile_031.gif


____________________________________








__________________________________________






#28 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 14 junio 2008 - 12:08






smile_031.gif


_____________________________________














_____________________________________________________







#29 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 18 junio 2008 - 02:50




smile_031.gif

_____________________________________________
















______________________________________________________






#30 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 21 junio 2008 - 02:22




smile_031.gif



______________________________________________




















__________________________________________________






#31 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 25 junio 2008 - 05:03



smile_031.gif



_______________________________

















______________________________________________________





#32 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 27 junio 2008 - 03:45




smile_031.gif


_________________________________________________




















_________________________________________________






#33 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 30 junio 2008 - 05:03



smile_031.gif


________________________________________


















______________________________________________________






#34 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 02 julio 2008 - 07:05



smile_031.gif



______________________________________


















________________________________________________





#35 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 05 julio 2008 - 06:39





smile_031.gif


SELECTIVIDAD SM

____________________________________________


Enunciado


Elabora un texto coherente (de no más de siete líneas) referente a un fenómeno biológico con las siguientes palabras: meiosis, variedad alélica, recombinación y evolución. (Se pueden utilizar las palabras más de una vez si fuese necesario).

Respuesta


La evolución es el resultado de dos tendencias: una que favorece la variedad alélica, es decir, la aparición de nuevos alelos mediante mutación o por recombinación, fenómeno que tiene lugar durante la meiosis; y otra antagónica que tiende a reducir la variabilidad genética y que es fruto de la selección natural que elimina los alelos cuya información es menos apta.




Enunciado


¿Qué papel han jugado los elementos abióticos en la evolución de las especies?. Razona la respuesta y pon un ejemplo.

Respuesta


El conjunto de los factores físico-químicos del ecosistema se denominan factores abióticos. Son los compuestos químicos orgánicos e inorgánicos básicos que forman parte del suelo, de las aguas y la atmósfera, así como la luz, la temperatura, la presión, etc. Los factores abióticos condicionan totalmente a la biocenosis, ya que muchas funciones vitales dependen de ellos.

Los factores físico-químicos, los mecanismos adaptativos y las interacciones con otras especies son fundamentales a la hora de estudiar la evolución de los organismos.

En su obra El origen de las especies, Darwin explica que el proceso de evolución se basa en
dos puntos: la variabilidad de la descendencia y la selección natural.

Por tanto, los individuos de una población, ante la falta de un factor abiótico indispensable, luchan por la supervivencia, en la cual se eliminan los menos aptos y persisten los mejor adaptados. Estos son los que se reproducen y transmiten sus caracteres.



Enunciado


Define los siguientes términos:
- Gen.
- Locus.
- Recombinación.
- Alelo.


Respuesta


Gen: Segmento de ADN (ARN en algunos virus) que constituye la unidad hereditaria de un ser vivo. Funcionalmente es el segmento de ADN con información precisa para dirigir la síntesis de un polipéptido.

Locus: Lugar que ocupa un gen en el cromosoma. En un locus cualquiera de un ser haploide hay un solo gen, en un diploide hay dos, en un triploide hay tres, etc. El plural, de locus, es loci. Un cromosoma tiene muchos loci.

Alelo: Es cada una de las dos alternativas que puede tener un gen. Por ejemplo, el gen que regula la textura de la semilla del guisante presenta dos alelos, uno que determina textura rugosa y otro lisa.

Recombinación: Es consecuencia directa del intercambio de información genética que tiene lugar en el sobrecruzamiento cromosómico meiótico. En este fenómeno los pares de cromosomas homólogos están estrechamente apareados y se adhieren en determinados puntos denominados quiasmas. En esta situación las cromátidas hermanas se entrecruzan y se fragmentan transversalmente dando lugar a un intercambio de ADN entre ellas.







________________________________________________________





#36 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 15 julio 2008 - 01:13





smile_031.gif


Gentileza de la Universidad Complutense de Madrid


AULA VIRTUAL DE GENÉTICA


Manuel Díez

Araceli Gallego

César Benito


http://www.ucm.es/info/genetica/AVG/
_______________________________________________







1.1.- En un organismo cuyo material hereditario es ADN de doble hélice, las proporciones A+T/+C y A+G/T+C de una de las dos hélices valen 0,5 y 0,2; respectivamente.

a) ¿Cuánto valdrán esas mismas proporciones en la hélice complementaria?.

b) ¿Cuánto valdrán en la molécula completa?.



SOLUCION



a) ¿Cuánto valdrán esas mismas proporciones en la hélice complementaria?.


Las proporciones de las bases nitrogenadas en un ADN de doble hélice son las siguientes:

A = T y G = C, Por tanto, A+G/T+C = 1.


Es decir, la Adenina (A) de una hélice empareja con la Timina (T) de la complementaria y viceversa, y la Guanina (G) de una hélice empareja con la Citosina ( C ) de la complementaria y al contrario.

Si la proporción A+T/G+C de una hélice es 0,5; esa misma proporción en la complementaria se obtiene de la siguiente forma:

Si una hélice posee una A en la complementaria hay T. Si una hélice tiene una T la complementaria posee una A. Cuando hay una G en la complementaria existe una C y, por último, si una hélice tiene una C la complementaria posee una G. Por tanto, la proporción A+T/G+C de una hélice es igual que la proporción T+A/C+G de la complementaria. Como se puede ver, ambas proporciones son iguales, por consiguiente, la proporción A+T/G+C de la hélice complementaria también valdrá 0.5.

Si la proporción A+G/T+C de una hélice es 0,2; esa misma proporción en la complementaria se obtiene de la siguiente manera:

Si una hélice posee una A en la complementaria hay T. Si una hélice tiene una G la complementaria posee una C. Cuando hay una T en la complementaria existe una A y, por último, si una hélice tiene una C la complementaria posee una G. Por tanto, la proporción A+G/T+C de una hélice es igual que la proporción T+C/A+G de la complementaria. Como se puede ver, esta proporción es justo la inversa de la solicitada. Por consiguiente, la proporción A+G/T+C de la hélice complementaria también valdrá 1/0.2.






b) ¿Cuánto valdrán en la molécula completa?.


Si la proporción A+T/G+C de una hélice es 0,5; esa misma proporción en la molécula completa se obtiene de la siguiente forma:

La proporción A+T/G+C ya hemos visto que es igual en ambas hélices, siendo su valor en este caso 0.5. Por tanto, también será igual en la molécula completa, es decir valdrá 0.5.

Si la proporción A+G/T+C de una hélice es 0,2; esa misma proporción en la molécula completa se obtiene de la siguiente manera:

Como hemos indicado al principio, en un ADN de doble hélice la proporción de A es igual a la de T y la proporción de G es igual a la de C, debido a las reglas de emparejamiento de las bases nitrogenadas. Por tanto, la proporción A+G/T+C valdrá 1.







_________________________________________________








#37 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 18 julio 2008 - 01:51







smile_031.gif


Agradecemos muy cordialmente a los profesores:


Manuel Díez

Araceli Gallego

César Benito


Su gentileza al autorizarnos el uso de este excelente material.

Universidad Complutense de Madrid


AULA VIRTUAL DE GENÉTICA


http://www.ucm.es/info/genetica/AVG/

_______________________________________________






Problema 1.2.-


1.2.- El ADN del bacteriofago ØX174 está formado por un 25% de A, 33% de T, 24% de G y 18 % de C.

a) ¿Corresponden estos porcentajes a lo esperado según el modelo de la “Doble Hélice” propuesto por Watson y Crick?

b) Haga una hipótesis que explique este resultado y proponga experimentos para comprobarla.






a) ¿Corresponden estos porcentajes a lo esperado según el modelo de la “Doble Hélice” propuesto por Watson y Crick?


Las proporciones de la bases nitrogenadas para el modelo del ADN doble hélice propuesto por Watson y Crick (1953) están basadas en la reglas de Chargaff (1950) y son las siguientes:

A = T, G = C y A+T = G+C. Por tanto, A+T/G+C=1

El ADN de ØX174 tiene A = 25%, T = 33%, G = 24% y C = 18 %. Por consiguiente, no se cumplen las reglas de Chargaff, existiendo diferentes proporciones de A y T, y diferentes proporciones de G y C.


b) Haga una hipótesis que explique este resultado y proponga experimentos para comprobarla.


El ADN de este virus no debe ser de doble hélice, ya que las proporciones de las bases nitrogenadas no se corresponden con lo esperado según el modelo de la Doble Hélice propuesto por Watson y Crick (1953).

Por tanto, la hipótesis que podríamos plantear es que se trata de un virus cuyo material hereditario es ADN de hélice sencilla.

Hipótesis = El ADN de ØX174 es de Hélice sencilla


Para comprobar esta hipótesis podríamos realizar varios experimentos:

Absorbancia a 260 nm antes y después de la desnaturalización con calor.

Desnaturalización: separación de la doble hélice del ADN en dos hélices sencillas.




El ADN doble hélice absorbe a 260 nm menos que el ADN desnaturalizado en estado de hélice sencilla. Si el ADN de ØX174 fuera de doble hélice esperaríamos un aumento de la absorbancia después de la desnaturalización, si el ADN de ØX174 fuera de hélice sencilla no debería aumentar la absorbancia después de la desnaturalización.



Centrifugación en gradiente de CsCl antes y después de la desnaturalización con calor.

Centrifugación en gradiente de CsCl: Permite separar las moléculas de ADN por su densidad, y la densidad del ADN es directamente proporcional a su contenido en G+C. A mayor contenido en G+C mayor densidad.

La desnaturalización del ADN doble hélice de algunos virus produce la separación de ambas hebras, pudiéndose separar posteriormente por centrifugación debido a su diferente composición en bases nitrogenadas, siendo una de ellas pesada (H) y otra ligera (L). Si el ADN de ØX174 fuera de doble hélice esperaríamos una banda antes de la desnaturalización con calor y dos bandas, una H y otra L, después de la desnaturalización. Si el ADN de ØX174 fuera de hélice sencilla obtendríamos una sola banda antes y después de la desnaturalización con calor.



Absorbancia a 260 nm y digestión del ADN con nucleasas específicas.

Existen nucleasas que digieren específicamente ADN de una hélice y nucleasas que degradan específicamente ADN de doble hélice. Cuando el ADN se degrada a nivel de nucleótidos se produce un aumento de la absorbancia a 260 nm. Si se mide la absorbancia a 260 nm antes y después de tratar el ADN de ØX174 con nucleasas específicas de ADN de una hélice, observaríamos un aumento de la absorbancia en el caso de que fuera de hélice sencilla. Sin embargo, si lo tratamos con nucleasas específicas de ADN de doble hélice no observaríamos aumento de la absorbancia en el caso de que fuera de hélice sencilla.

Utilización de columnas de Hidroxiapatita y de Nitrato de celulosa.

Las columnas de hidroxiapatita retienen específicamente ADN de doble hélice. La columnas de nitrato de celulosa retienen específicamente ADN de una hélice. Si el ADN de ØX174 fuera de hélice sencilla quedaría atrapado en las columnas de nitrato de celulosa y no en las de hidroxiapatita.


______________________________________________






#38 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 21 julio 2008 - 04:24








smile_031.gif



Agradecemos muy cordialmente a los profesores:


Manuel Díez

Araceli Gallego

César Benito


Su gentileza al autorizarnos el uso de este excelente material.

Universidad Complutense de Madrid


AULA VIRTUAL DE GENÉTICA


http://www.ucm.es/info/genetica/AVG/

_______________________________________________








1.3.- En la siguiente tabla se indican las densidades en g/cm3 de un polímero sintético y de los ADNs de cuatro especies diferentes:

Procedencia del ADN.......................Densidad (g/cm3)

Polímero sintético A-T..........................1,679
Diploccocus pneumoniae......................1,700
Escherichia coli....................................1,710
Serratia marcescens............................1,718
Mycobacterium phlei............................1,732



a) Escribir las distintas muestras de ADN en orden decreciente de temperatura de fusión -tm - .

b) Situar las muestras en orden creciente de contenido en G+C.

c) Determinar el porcentaje de G+C de la bacteria E. coli.










a densidad del ADN está directamente relacionada con el contenido en G+C, de manera que una mayor densidad significa un mayor contenido en G+C.

A y T emparejan mediante dos puentes de hidrógeno (doble enlace), mientras que G y C emparejan formando tres puentes de hidrógeno (triple enlace). Cuanto mayor es el contenido en G+C de un ADN doble hélice, mayor proporción de triples enlaces posee ese ADN y, por consiguiente, es necesario suministrar mayor calor para romper dichos enlaces y desnaturalizar el ADN. La temperatura de fusión ™ se define como la temperatura a la que se ha desnaturalizado la mitad del ADN de la muestra que estamos calentando. Por tanto, cuanto mayor es la densidad del ADN, mayor es su contenido en G+C y mayor es su temperatura de fusión - tm -.

a) Escribir las distintas muestras de ADN en orden decreciente de temperatura de fusión - tm -.


Tendremos que comenzar por la de mayor TM (mayor contenido en G+C y mayor densidad) y terminar por la de menor Tm (menor contenido en G+C y menor densidad).


..........................................Densidad (g/cm3).................Orden Decreciente TM

Mycobacterium phlei....................1,732...............................1º
Serratia marcescens.....................1,718..............................2º
Escherichia coli.............................1,710..............................3º
Diploccocus pneumoniae...............1,700...............................4º
Polímero sintético A-T...................1,679..............................5º



b) Situar las muestras en orden creciente de contenido en G+C.


Tendremos que comenzar por la de menor contenido en G+C (menor densidad) y terminar por la de mayor contenido en G+C (mayor densidad).


..............................................Densidad (g/cm3)...................Orden Creciente G+C

Polímero sintético A-T...................1,679........................................1º
Diploccocus pneumoniae...............1,700........................................2º
Escherichia coli.............................1,710........................................3ºSerratia marcescens.....................1,718........................................4º
Mycobacterium phlei.....................1,732........................................5º



c) Determinar el porcentaje de G+C de la bacteria E. coli.


Existe una fórmula empírica que relaciona la densidad en CsCl con el contenido en G+C. Dicha fórmula es la siguiente:

r = 1.660 + 0.00098 (G+C)


Sabiendo que la densidad de E. coli es r = 1.710, podemos sustituir en la fórmula y obtendremos que G+C = 51%.



________________________________________________________








#39 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 30 julio 2008 - 02:55




smile_031.gif


Continuamos....


________________________________________________






1.4.- Los ADNs de dos organismos distintos tienen idéntico porcentaje de G+C.

a) ¿Indica este dato que ambos poseen ADN de doble hélice?

b) ¿Significa que tienen la misma secuencia de bases nitrogenadas?

c) ¿Indica que tienen la misma longitud?

d) ¿Sugiere que poseen la misma velocidad de renaturalización?

e) ¿Significa que son de igual densidad ?

f) ¿Tendrían estos dos ADNs la misma temperatura de fusión ™?







a) ¿Indica este dato que ambos poseen ADN de doble hélice?


El porcentaje en G+C del ADN no nos indica si se trata de ADN doble hélice o de ADN de hélice sencilla. Para saber si se trata de ADN doble hélice deben cumplirse las reglas de Chargaff:

A = T y G = C, Por tanto, A+G/T+C = 1.





b) ¿Significa que tienen la misma secuencia de bases nitrogenadas?


El conocimiento del porcentaje en G+C del ADN no implica el conocimiento de la secuencia de nucleótidos, por tanto dos ADNs pueden tener igual porcentaje en G+C y distinta secuencia.

Suponga dos ADNs distintos con porcentaje en G+C del 40%.

(G+C) = 8/20 = 0.4

5' AATTGGCCAATTGGCCAATT 3' 5' AAAAAATTTTTTGGGGCCCC 3'





c) ¿Indica que tienen la misma longitud?


El conocimiento del porcentaje en G+C del ADN no implica el conocimiento de su longitud, por tanto dos ADNs pueden tener igual porcentaje en G+C y distinta longitud.

Suponga dos ADNs distintos con porcentaje en G+C del 40%.

(G+C) = 4/10 = 0.4 (G+C) = 8/20 = 0.4

5' ATGCATGCAT 3' 5' AAAAAATTTTTTGGGGCCCC 3'






d) ¿Sugiere que poseen la misma velocidad de renaturalización?


Renaturalización: formación de ADN doble hélice a partir de ADN de hélice sencilla.

La velocidad de renaturalización del ADN no depende del contenido en G+C, depende del número de veces que estén repetidas las distintas secuencias de nucleótidos que posea el organismo analizado. Cuantas más veces está repetida una determinada secuencia tanto más probable es que encuentre una secuencia complementaria para formar de nuevo la doble hélice, por consiguiente, necesita menos tiempo para encontrar una secuencia complementaria y reasociar.





e) ¿Significa que son de igual densidad ?


El contenido en G+C está directamente relacionado con la densidad del ADN. Por tanto, dos ADNs con idéntico contenido en G+C tienen la misma densidad.





f) ¿Tendrían estos dos ADNs la misma temperatura de fusión -Tm- ?


El contenido en G+C está directamente relacionado con la densidad del ADN. Por tanto, dos ADNs con idéntico contenido en G+C tienen la misma densidad. A y T emparejan mediante dos puentes de hidrógeno (doble enlace), mientras que G y C emparejan formando tres puentes de hidrógeno (triple enlace). Cuanto mayor es el contenido en G+C de un ADN doble hélice, mayor proporción de triples enlaces posee ese ADN y, por consiguiente, es necesario suministrar mayor calor para romper dichos enlaces y desnaturalizar el ADN. La temperatura de fusión -Tm- se define como la temperatura a la que se ha desnaturalizado la mitad del ADN de la muestra que estamos calentando. Por tanto, cuanto mayor es la densidad del ADN, mayor es su contenido en G+C y mayor es su temperatura de fusión -Tm- .

Dos ADNs con igual contenido en G+C poseen igual temperatura de fusión -Tm-.


______________________________________________________









#40 Ge. Pe.

Ge. Pe.

    God of Forum

  • Administrators
  • 11.570 Mensaje(s)
  • Gender:Male

Publicado el 03 agosto 2008 - 07:52






smile_031.gif

Agradecemos muy cordialmente a los profesores:


Manuel Díez

Araceli Gallego

César Benito


Su gentileza al autorizarnos el uso de este excelente material.

Universidad Complutense de Madrid

AULA VIRTUAL DE GENÉTICA

http://www.ucm.es/info/genetica/AVG/


___________________________________________________






1.5.- Dos especies eucariontes diploides diferentes tienen igual cantidad de ADN, 2 x 108 pares de bases:

a) La especie A tiene un mayor contenido en guanina que la especie B.

b) La especie A posee un 20% de secuencias altamente repetidas y la especie B un 40%.

c) La especie A presenta las secuencias altamente repetidas localizadas en las regiones próximas a los centrómeros de los cromosomas, mientras que las secuencias altamente repetidas de la especie B se encuentran en regiones teloméricas.


Proponga tres experimentos, al menos uno por cada una de las diferencias indicadas entre las especies A y B, que pongan de manifiesto las características mencionadas.





Todas las especies eucariontes tienen ADN doble hélice como material hereditario, por tanto, se cumplen las reglas de Chargaff: A = T, G = C y (A+G)/(T+C) = 1.



a) La especie A tiene un mayor contenido en guanina que la especie B.


Si la especie A tiene mayor contenido en G que la especie B, teniendo en cuenta que G = C, podemos decir que la especie A tiene mayor contenido en C que la especie B y, por consiguiente, que la especie A tiene un mayor contenido en G+C que la especie B. Si además, tenemos en cuenta que el contenido en G+C está directamente relacionado con la densidad del ADN, podemos afirmar que el ADN de la especie A tendrá mayor densidad que el ADN de la especie B.


Experimento propuesto: Centrifugación en gradiente de CsCl




A y T emparejan mediante dos puentes de hidrógeno (doble enlace), mientras que G y C emparejan formando tres puentes de hidrógeno (triple enlace). Cuanto mayor es el contenido en G+C de un ADN doble hélice, mayor proporción de triples enlaces posee ese ADN y, por consiguiente, es necesario suministrar mayor calor para romper dichos enlaces y desnaturalizar el ADN. La temperatura de fusión -Tm- se define como la temperatura a la que se ha desnaturalizado la mitad del ADN de la muestra que estamos calentando. Por tanto, cuanto mayor es la densidad del ADN, mayor es su contenido en G+C y mayor es su temperatura de fusión -Tm-. Por tal motivo, la especie A tendrá mayor temperatura de fusión que la especie B.


Experimento propuesto: Desnaturalización para averiguar la temperatura de fusión -Tm-





b) La especie A posee un 20% de secuencias altamente repetidas y la especie B un 40%.


En el supuesto de que las secuencias altamente repetidas presentarán un contenido en G+C distinto al resto del ADN, podríamos centrifugar en gradiente de CsCl. Al centrifugar obtendríamos dos bandas una correspondiente al ADN principal (mayoritario) y otra correspondiente al ADN satélite (altamente repetido). La banda correspondiente al ADN satélite contendría mayor cantidad de ADN en el caso de la especie B, detectándose esta mayor cantidad de ADN por absorbancia a 260 nm.

Experimento propuesto: Centrifugación en gradiente de CsCl y Absorbancia a 260 nm



Teniendo en cuenta que las secuencias altamente repetidas reasocian en muy poco tiempo (rápidamente) en experimentos de renaturalización, especie B mostrará un porcentaje mayor que la especie A de ADN que reasocia en poco tiempo.


Experimento propuesto: Estudio de la cinética de renaturalización





c) La especie A presenta las secuencias altamente repetidas localizadas en las regiones próximas a los centrómeros de los cromosomas, mientras que las secuencias altamente repetidas de la especie B se encuentran en regiones teloméricas.


Si suponemos que en muchas especies las secuencias altamente repetidas tienen un diferente contenido en G+C, podremos aislar mediante centrifugación en gradiente de CsCl el ADN altamente repetido (ADN satélite). Una vez aislado el ADN altamente repetido de ambas especies, procederíamos marcarlo con un sistema no radiactivo (utilizando biotina o dig-oxigenina).

Posteriormente, conseguiríamos metafases mitóticas de ambas especies (momento en el que los cromosomas alcanzan el máximo grado de contracción y tienen perfectamente definida su morfología) y realizaríamos una hibridación "in situ" mediante fluorescencia (FISH) empleando como sonda marcada el ADN altamente repetido. En la especie A el marcaje se observaría en las regiones centroméricas y en la especie B el marcaje aparecería en las regiones teloméricas.


Experimento propuesto: Hibridación "in situ" mediante fluorescencia

Especie A




Especie B




___________________________________________________









Spin Palace - Spanish